View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19050_low_26 (Length: 352)

Name: NF19050_low_26
Description: NF19050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19050_low_26
NF19050_low_26
[»] chr8 (1 HSPs)
chr8 (284-330)||(15155323-15155369)


Alignment Details
Target: chr8 (Bit Score: 47; Significance: 9e-18; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 284 - 330
Target Start/End: Complemental strand, 15155369 - 15155323
Alignment:
284 cgtataaattgtcatcttttaattatatttctatccatgctatacca 330  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
15155369 cgtataaattgtcatcttttaattatatttctatccatgctatacca 15155323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University