View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19050_low_38 (Length: 285)
Name: NF19050_low_38
Description: NF19050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19050_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 16 - 178
Target Start/End: Original strand, 42814439 - 42814600
Alignment:
| Q |
16 |
attataatgtataacaaagttttctttcaatagatctaacattgttcatctgttttctaaactgaataataggaattcagacctcttgttaaaccgaaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42814439 |
attataatgtataacaaagttttctttcgatagatctaacactgttcatctgttttctaaactgaataataggaattcagacctcttgttaaattgaaaa |
42814538 |
T |
 |
| Q |
116 |
taatctctttacactctcatgcaattgctctttggtgtattttcttttgtgtcataagagcag |
178 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42814539 |
taatctctttacactctcatgcaa-tgctctttggtgtattttcttttgcgtcataagagcag |
42814600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 243 - 278
Target Start/End: Original strand, 42814666 - 42814701
Alignment:
| Q |
243 |
cctatgagattctaaatgcataattctcaatatttt |
278 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42814666 |
cctatgagattctaaatgcataattctgaatatttt |
42814701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University