View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19050_low_42 (Length: 263)
Name: NF19050_low_42
Description: NF19050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19050_low_42 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 3489717 - 3489970
Alignment:
| Q |
1 |
cttataacaatttagatattaaataattactctcttt-aggttttcttgtgctgaaattttgaataggccttggtattgcatttttctgttattaaccat |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3489717 |
cttataacaatttagatattaaataattactctcttttaggttttcttgtgctgaaattttgaataggccttggtattgcatttttctgttattaaccat |
3489816 |
T |
|
| Q |
100 |
tttctgttatcaaatggcagtggaatgtgttgatgtaccagtgatttctggactaactatgtcgacacatgttggtgtattaagaagaagacacacttct |
199 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3489817 |
tttctgttatcaaatggcagagaaatgtgttgatgtaccagtgatttctggactaactatgtcgacacgtgttggtgtattaagaagaagacacacttct |
3489916 |
T |
|
| Q |
200 |
ggaaaaactagtcctggaaataatgaagaaaaacttgttcctcatattcttcga |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3489917 |
ggaaaaactagtcctggaaataatgaagaaaaacttgttcctcattatcttcga |
3489970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University