View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19050_low_47 (Length: 248)
Name: NF19050_low_47
Description: NF19050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19050_low_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 8 - 230
Target Start/End: Original strand, 42814701 - 42814923
Alignment:
| Q |
8 |
tatttttatatttgatttcttaacatgtgtcttatgccataaatcaacatttctaacttgtgcccttaattatgccacaaattaacatttcttttattat |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
42814701 |
tatttctatatttgatttcttaacatgtgtcttatgccataaatcaacatttttaacttgtgcccttaattatgctacaaattaacatctcttttattat |
42814800 |
T |
 |
| Q |
108 |
tatttattacgtgttaatttgtcatttaatggtaagaaataacaccgttctaagagccacgcatttattaatgatgtgattattgaatcctctacacggt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42814801 |
tatttattacgtgttaatttgtcatttaatgataagaaatgacaccgttctaagagccacgcatttattaatgatgtgattattggatcctctacacggt |
42814900 |
T |
 |
| Q |
208 |
ccaagtcctacaaaactaactag |
230 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
42814901 |
ccaagtcctacaaaactcactag |
42814923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University