View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19050_low_54 (Length: 238)
Name: NF19050_low_54
Description: NF19050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19050_low_54 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 2 - 220
Target Start/End: Complemental strand, 45585115 - 45584884
Alignment:
| Q |
2 |
atattaccccacagctgcgtgtcctaaaattcttggaaacctagcagtaggtgcctgaaaaagaaaattacgggattttcatttgaaataatttttgaat |
101 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | | |
|
|
| T |
45585115 |
atattaccccacagcttcgtgtcctaaaattcttggaaacctagcagtaggtgcctgaaaaagaaaattacgggattttcatttgaaataattatagtaa |
45585016 |
T |
 |
| Q |
102 |
gga-------------gatattttggatttgtgcttactgaagaattcattttccaaaaggtgacatcagagtggcagagagatgtgcataaaattttga |
188 |
Q |
| |
|
| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45585015 |
ctactactactagtacgatgctttggatttgtgcttactgaagaattcattttccaaaaggtgacatcagagtggcagagagatgtgcataaaattttga |
45584916 |
T |
 |
| Q |
189 |
tccgtacttcccatgatttaggtgggtctaat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45584915 |
tccgtacttcccatgatttaggtgggtctaat |
45584884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University