View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19051_low_4 (Length: 364)
Name: NF19051_low_4
Description: NF19051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19051_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 23 - 348
Target Start/End: Complemental strand, 30480721 - 30480396
Alignment:
| Q |
23 |
aatggacttgagaatccaaaaaactctgcaaaaatgtcatctgcattcctcggattgaaccgaaacgatccaggcatatctcctgtggaatagaaactag |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30480721 |
aatggacttgagaatccaaaaaactctgcaaaaatgtcatctgcattcctcggattgaaccgaaacgacccaggcatatctcctgtggaatagaaactag |
30480622 |
T |
|
| Q |
123 |
ttccacctccactaccagcatcaggaggaggaacttgaccctttaaaccttcttccccatattgatcatagattgctttcttttcaggatcactaagtac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30480621 |
ttccacctccactaccagcatcaggaggaggaacttgaccctttaaaccttcttccccatattgatcatagattgctttcttttcaggatcagcaagtac |
30480522 |
T |
|
| Q |
223 |
ctacaataaccacaattcacatcacagtaagcataacccaaataaataattaaattattggattttcattggttagctcatgatttcaaagaaaactaaa |
322 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30480521 |
ctacaataaccacaattcacatcatagtaagcataacccaaataaataattaaattattggattttcattatttagctcatgatttcaaagaaaactaaa |
30480422 |
T |
|
| Q |
323 |
aatttgcaatacccttacgaaaaatt |
348 |
Q |
| |
|
||||||||||||||||| |||||||| |
|
|
| T |
30480421 |
aatttgcaatacccttatgaaaaatt |
30480396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 170 - 216
Target Start/End: Complemental strand, 4142315 - 4142269
Alignment:
| Q |
170 |
ccttcttccccatattgatcatagattgctttcttttcaggatcact |
216 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
4142315 |
ccttcttctccatattgatcataaattgctttcttttgtggatcact |
4142269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University