View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19053_low_15 (Length: 257)
Name: NF19053_low_15
Description: NF19053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19053_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 59 - 246
Target Start/End: Original strand, 30872159 - 30872342
Alignment:
| Q |
59 |
ctggacttcgatgctctttttgttcaaaaaggaaatagcctctccaatccaagaatatttgaaagnnnnnnnnnnnnggataaatgatgtgtttgttttt |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30872159 |
ctggacttcgatgctctttttgttcaaaaaggaaatagcctctccaatccgagaatatttgaaa----aaaaaaataggataaatgatgtgtttgttttt |
30872254 |
T |
 |
| Q |
159 |
tagattaattaataaatggtatcaaacttcaattttagcttttcaaattttatcctaatttaaataaataatagttccactcctctct |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30872255 |
tagattaattaataaatggtatcaaacttcaattttagcttttcaaattttatcctaatttaaataaataatagttccactcctctct |
30872342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University