View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19053_low_17 (Length: 248)

Name: NF19053_low_17
Description: NF19053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19053_low_17
NF19053_low_17
[»] chr8 (1 HSPs)
chr8 (8-47)||(29608778-29608817)


Alignment Details
Target: chr8 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 8 - 47
Target Start/End: Complemental strand, 29608817 - 29608778
Alignment:
8 gagacgactatagtgatgatctgtaaaaatgggtgtcttc 47  Q
    ||||||||||||||||||||||||||||||||||||||||    
29608817 gagacgactatagtgatgatctgtaaaaatgggtgtcttc 29608778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University