View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19053_low_19 (Length: 229)
Name: NF19053_low_19
Description: NF19053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19053_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 21 - 214
Target Start/End: Original strand, 12061049 - 12061242
Alignment:
| Q |
21 |
gatagaaatcttcatacatcttcctctgcgaaacgttggtcagtagctggcttcgacatacctcttgaaaagctattgggtatgtctggttccattcctc |
120 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12061049 |
gatagaaatcttcatacgtcttcctctgcgaaacgttggtcagtagctggcttcgacatacctcttgaaaagctattgggtatgtctggttccattcctc |
12061148 |
T |
 |
| Q |
121 |
tttgttgcttgttctttgacctaccagagtctactttgtgtactataaggaggatttattttcattactttccgacagtttgttgatttatatt |
214 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12061149 |
tttgttgcttgttctttgacctaccatagtctactttgtgtactataaggaggatttattttcattactttccgacagtttgttgatttatatt |
12061242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University