View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19053_low_8 (Length: 337)
Name: NF19053_low_8
Description: NF19053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19053_low_8 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 8e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 219 - 337
Target Start/End: Complemental strand, 12061616 - 12061498
Alignment:
| Q |
219 |
tccactataacttgaattcgatttttaaaattcctcttttctaacggataacgaataaataatgtgtgctaataataagttttaattttacaagaccctt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12061616 |
tccactataacttgaattcgatttttaaaattcctcttttataaccggtaacgaataaataatgtgtgctaataataagttttaattttacaagagcctt |
12061517 |
T |
|
| Q |
319 |
aatttttatgtgattatct |
337 |
Q |
| |
|
||||||||||| ||||||| |
|
|
| T |
12061516 |
aatttttatgtcattatct |
12061498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 49 - 164
Target Start/End: Complemental strand, 12061781 - 12061670
Alignment:
| Q |
49 |
taaaaatgtttgaaccttctttattnnnnnnntataatctaatatagattcaacgtaggttaaaccatagacctaagtcggtcattcaccattgttacat |
148 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| || ||||| | ||||||||| |
|
|
| T |
12061781 |
taaaaatgtttgaaccttctttattaaaaaaatataatttaatatagattcaacgtaggttaaaccatagaccta----tgttattcatcgttgttacat |
12061686 |
T |
|
| Q |
149 |
aaatatgaactgatcc |
164 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
12061685 |
aattatgaactgatcc |
12061670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University