View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19054_high_14 (Length: 240)
Name: NF19054_high_14
Description: NF19054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19054_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 20 - 230
Target Start/End: Complemental strand, 24562215 - 24562005
Alignment:
| Q |
20 |
actaatagtgcggctgatgttgcgcattggattgactatggatatgagagatctatgttttattttatttgtattctcttttggctcgataatttatgat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24562215 |
actaatagtgcggctgatgttgcgcattggattgactatggatatgagagatctatgttttattttatttgtattctcttttggctcgataatttatgat |
24562116 |
T |
 |
| Q |
120 |
attatgctttactaacagaacatgactgtctcattagnnnnnnnnnagcttacagttttttgatttctcccatctttatgttttcatcagaaatcattgt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24562115 |
attatgctttactaacagaacatgactgtctcattagtttttttttagcttacagttttttgatttctcccatctttatgttttcatcagaaatcattgt |
24562016 |
T |
 |
| Q |
220 |
atgaagtctgt |
230 |
Q |
| |
|
||||||||||| |
|
|
| T |
24562015 |
atgaagtctgt |
24562005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University