View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19055_low_13 (Length: 312)
Name: NF19055_low_13
Description: NF19055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19055_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 10 - 295
Target Start/End: Original strand, 26577646 - 26577933
Alignment:
| Q |
10 |
aagaatatcacaaaagtctttccaccacacagaagacaaccaaccccctctgttaattcgccctttctcagtctcgtatttaactgctaacacatacata |
109 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26577646 |
aagaatatcacacaagtctttccaccacacagaagacaaccaaccccctctgttaattcgccctttctcagtttcgtatttaactgctaacacatacata |
26577745 |
T |
 |
| Q |
110 |
cgccatccatcacccgcaagccttatatcttaatttttctcattctaaaataagagatatcgatatgtctcaaaattaaattccaaccgttccgaattaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26577746 |
cgccatccatcacccgcaagccttatatcttaatttttctcattctaaaataagagatatcaatatgtctcaaaattaaattccaaccgttccgaattaa |
26577845 |
T |
 |
| Q |
210 |
atttgaaacac--atgcacattttatttctattctgatattaccctttgcaaattgtgtgatccgatgtttcaatgaatggacaaaag |
295 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26577846 |
atttgaaacacatatgcacattttatttctattctgatattaccctttgcaaattgtgtgatccgatgtttcaatgaatggacaaaag |
26577933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 50
Target Start/End: Original strand, 16126549 - 16126589
Alignment:
| Q |
10 |
aagaatatcacaaaagtctttccaccacacagaagacaacc |
50 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| ||||||| |
|
|
| T |
16126549 |
aagaatatcacataagtccttccaccacacagaggacaacc |
16126589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University