View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19055_low_25 (Length: 233)
Name: NF19055_low_25
Description: NF19055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19055_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 41713493 - 41713273
Alignment:
| Q |
1 |
ataatggtattgaatatggtgacatgcagcttatttctgaagcttatgatgttttgaagcatgttggtggattgtccaattctgaacttgctgatatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41713493 |
ataatggtattgaatatggtgacatgcagcttatttctgaagcttatgatgttttgaagcatgttggtggattgtccaattctgaacttgctgatatttt |
41713394 |
T |
 |
| Q |
101 |
tgctgagtggaataatggtgagcttgagagttttcttattgagattactgctgatatttttaaggtgaaggatgaaggtggggatgggtatttggtggat |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41713393 |
tgctgagtggaatagtggtgagcttgagagttttcttattgagattactgctgatatttttaaggtgaaggatgaaggtggggatgggtatttggtggat |
41713294 |
T |
 |
| Q |
201 |
aagattttggataagactggt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
41713293 |
aagattttggataagactggt |
41713273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 5751808 - 5751866
Alignment:
| Q |
1 |
ataatggtattgaatatggtgacatgcagcttatttctgaagcttatgatgttttgaag |
59 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||| |||| ||||| ||||| |||||| |
|
|
| T |
5751808 |
ataatggaattgaatatggtgacatgcagctgattgctgaggcttacgatgtgttgaag |
5751866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University