View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19056_low_1 (Length: 432)
Name: NF19056_low_1
Description: NF19056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19056_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 314; Significance: 1e-177; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 19 - 365
Target Start/End: Original strand, 2012974 - 2013320
Alignment:
| Q |
19 |
tttgtgtccaaggggatctgcgacatgtaaacttcactttgacttgcagccggatatgtaatcttcactttgacttacatccgaccctacgtctttttta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2012974 |
tttgtgtccaaggggatctgcgacatgtaaacttcactttgacttgcagccggatatgtaatcttcactttgacttacatccgaccctacgtctttttta |
2013073 |
T |
|
| Q |
119 |
attatagttgtgaattgtgatcacaaaggcaattgtgataatttattataattttgttcatttttacgcaaactgcggttggtataggacaaattgattt |
218 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2013074 |
ataatagttgtgaattgtgatcacaaaggcaattgtgataatttattataattttgttcatttttacgcaaactgcggttggtataggacaaattgattt |
2013173 |
T |
|
| Q |
219 |
tgatagctactggggctttatgtggattaaacggcggtattttcatatttttatgtattcagactcagactcagacggcttttactattttgcnnnnnnn |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2013174 |
tgatagctactggggctttatgtggattaaacggcagtattttcatatttttatgtattcagactcagactcagacggcttttactattttgcaaaaaaa |
2013273 |
T |
|
| Q |
319 |
tgtccaatagaaatgcttggtagttttaatggcattgactctactgc |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2013274 |
tgtccaatagaaatgcttggtagttttaatggcattgaccctactgc |
2013320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 63
Target Start/End: Original strand, 2019682 - 2019726
Alignment:
| Q |
19 |
tttgtgtccaaggggatctgcgacatgtaaacttcactttgactt |
63 |
Q |
| |
|
||||||||||| ||| |||||||||||||| |||||||||||||| |
|
|
| T |
2019682 |
tttgtgtccaatgggctctgcgacatgtaatcttcactttgactt |
2019726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 21 - 61
Target Start/End: Original strand, 2014383 - 2014423
Alignment:
| Q |
21 |
tgtgtccaaggggatctgcgacatgtaaacttcactttgac |
61 |
Q |
| |
|
||||||||||||| |||| ||||||||| |||||||||||| |
|
|
| T |
2014383 |
tgtgtccaaggggttctgagacatgtaatcttcactttgac |
2014423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University