View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19056_low_5 (Length: 262)
Name: NF19056_low_5
Description: NF19056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19056_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 13 - 251
Target Start/End: Original strand, 31415731 - 31415967
Alignment:
| Q |
13 |
cataaattttctcctcttgttttcatgatctcttgctttacctgtccaccacttctcgccttttctgtagccgcatcatcgtagtttgatacctttacca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31415731 |
cataaattttctcctcttgttttcatgatctcttgctttacctgtccaccacttctcgccttttctgtagccgcatcatcgtagtttgatacctttacca |
31415830 |
T |
|
| Q |
113 |
tgttttggataatacctcccctatttttgtgaagtagacttcgcgaattggccatactccggccaaagctggttacctaagctacaacacagtcaaatat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
31415831 |
tgttttggataatacctcccctatttttgtgaagttgacttcgcgaattggccatactccggcc--agctggttacctaagcgacaacacagtcaaatat |
31415928 |
T |
|
| Q |
213 |
cccatcgtaaatgaaacattctagacaactttaagtatt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31415929 |
cccatcgtaaatgaaacattctagacaactttaagtatt |
31415967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University