View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19057_high_4 (Length: 314)
Name: NF19057_high_4
Description: NF19057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19057_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 19 - 299
Target Start/End: Original strand, 35043233 - 35043513
Alignment:
| Q |
19 |
ggaagcaatcttttgtagttcaaagacccagcatgttttaaaaacttaacccgtgggcagcgatttagaacctgttcaaaattacttgatcaaatatatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35043233 |
ggaagcaatcttttgtagttcaaagacccagcatgttttaaaaacttaacccgtgggcagcgatttagaacctgttcaaaattacttgatcaaatatatt |
35043332 |
T |
 |
| Q |
119 |
ttcaagaaagnnnnnnntcaacataaaagaaaaggtattactataatcaatgagaaagagaggggtaaaacttaaaagaatgcaggtcttttggagatat |
218 |
Q |
| |
|
||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35043333 |
ttcgagaaagaaaaaaatcaacataaaagaaaaggtattactataatcaatgagaaagagaggggtaaaacttaaaagaatgcaggtcttttggagatat |
35043432 |
T |
 |
| Q |
219 |
atacacaaacaattatggttctcaccggtgtagtcttggattcggaaccatttttcatctcaccagcaaaactagcttttt |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35043433 |
atacacaaacaattatggttctcaccggtgtagtcttggattcggaaccatttttcatctcaccagcaaaactagcttttt |
35043513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University