View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19057_high_5 (Length: 268)
Name: NF19057_high_5
Description: NF19057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19057_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 13 - 239
Target Start/End: Original strand, 30612730 - 30612956
Alignment:
| Q |
13 |
aatattgcagatgaaggagagaaaagagaataagcaacaatgatggagatcctttgattttggtggtgaaggaagttgtcttgtgtatttatttatggca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30612730 |
aatattgcagatgaaggagagaaaagagaataagcaacaatgatggagatcctttgattttggtggtgaaggaagttgtcttgtgtatttatttatggca |
30612829 |
T |
 |
| Q |
113 |
aatgttgtttatagcgaaaattcaatccgcctaaatttttacaaccttgaaaatgcaacatcctttatttttggtaactaacatatttgtaagtgcgcaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30612830 |
aatgttgtttatagcgaaaattcaatccgcctaaatttttacgaccttgaaaatgcaacatcttttatttttggtaactaacatattcgtaagtgcgcaa |
30612929 |
T |
 |
| Q |
213 |
tttatgtgagataatttaacttcttaa |
239 |
Q |
| |
|
|||||||||||||||||| |||||||| |
|
|
| T |
30612930 |
tttatgtgagataatttagcttcttaa |
30612956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University