View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19057_low_10 (Length: 221)
Name: NF19057_low_10
Description: NF19057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19057_low_10 |
 |  |
|
| [»] scaffold0493 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0493 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: scaffold0493
Description:
Target: scaffold0493; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 90 - 203
Target Start/End: Original strand, 7538 - 7651
Alignment:
| Q |
90 |
gttgtttcggacaaccatgtagctaaattcgtgatagttgttaatttgtcattttagcttccaccaacgtaaaaatctaatcaagtccacggtcagtatt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7538 |
gttgtttcggacaaccatgtagctaaattcgtgatagttgttaatttgtcattttagcttccaccaacgtaagaatctaatcaagtccacggtcagtatt |
7637 |
T |
 |
| Q |
190 |
ttctgctatacttc |
203 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7638 |
ttctgctatacttc |
7651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University