View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19057_low_6 (Length: 256)

Name: NF19057_low_6
Description: NF19057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19057_low_6
NF19057_low_6
[»] chr8 (1 HSPs)
chr8 (1-239)||(35043491-35043729)


Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 35043491 - 35043729
Alignment:
1 ctcaccagcaaaactagcttttttgttattgcttccttttgaaggcgtctttgaaccattgactaggccattcagaagactttttgttttgccaccacca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35043491 ctcaccagcaaaactagcttttttgttattgcttccttttgaaggcgtctttgaaccattgactaggccattcagaagactttttgttttgccaccacca 35043590  T
101 tgtgttacagtgtctggtaacgccggtttttcagagatgatcttctctgactgtgaactagattcttcatttgagacggtgatgtgacttaaaaccacaa 200  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
35043591 tgtgttacagtgtctggtaacgccagtttttcagagatgatcttctctgactgtgaactagattcttcatttgagacggtgacgtgacttaaaaccacaa 35043690  T
201 catcgtcatttttgcaaattgcatggctgcttgtttcat 239  Q
    |||||||||||||||||||||||||||||||||||||||    
35043691 catcgtcatttttgcaaattgcatggctgcttgtttcat 35043729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University