View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19058_high_20 (Length: 444)
Name: NF19058_high_20
Description: NF19058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19058_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 160 - 428
Target Start/End: Original strand, 32360724 - 32360992
Alignment:
| Q |
160 |
gaggtaacataatataacccggtttaatttgttactaacactaacttgggatgggaccaggcccaatgttgtttggttacttccttcctcgtgttcttgt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32360724 |
gaggtaacataatataacccggtttaatttgttactaacactaacttgggatgggaccaggcccaatgttgtttggttacttccttcctcgtgttcttgt |
32360823 |
T |
|
| Q |
260 |
gtgtgtcgggttatttatgtttcaaattgtatgggacccagatagatccctattaaatcggtgttagtgcacgtttactaggttttgtgatgtgattttt |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32360824 |
gtgtgtcgggttatttatgtttcaaattgtatgggacccagatagatccctattaaatcggtgtgagtgcacgtttactaggttttgtgatgtgattttt |
32360923 |
T |
|
| Q |
360 |
gccaatgtgtttgagctccaaactcatcttatcataaggatgagttgtcttctttaaacaccaaaatac |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
32360924 |
gccaatgtgtttgagctccaaactcatcttatcatacggatgagttgtcttctttaaacatcaaaatac |
32360992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 32360569 - 32360657
Alignment:
| Q |
1 |
agagaaaacaaagaatgcggctgatgagtgagtttgagagagttgggatctgtcgcgtgcaagtgcaagtgcaaagtgaagtgtgtgagggtaaa |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32360569 |
agagaaaacaaagaatgcggctgatgagtgagtttgagagagttgggatctgtcgc------gtgcaagtgcaaagtgaagtgtgtgagggtaaa |
32360657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University