View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19058_high_26 (Length: 413)
Name: NF19058_high_26
Description: NF19058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19058_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 383; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 383; E-Value: 0
Query Start/End: Original strand, 1 - 403
Target Start/End: Complemental strand, 43009104 - 43008702
Alignment:
| Q |
1 |
ccctttgcttggtccagatgaaggaactttccccttaggaagcatgttcaggatcaatggcccatatgattttgcaccgcctctttcccgtactactgat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43009104 |
ccctttgcttggtccagatgaaggaactttccccttagggagcatgttcaggatcaatggcccatatgattttgcaccgcctctttcccgtactactgat |
43009005 |
T |
 |
| Q |
101 |
atgtgtccttccttctcctccggcattgccctctcacttggaagtgcgatgtttgaggtttctgcaagctggctgaaatcattcaagggcctagcagatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43009004 |
atgtgtccttccttctcctccggcattgccctctcacttggaagtgcgatgtttgaggtttctgcaagctggctgaaatcattcaagggcctagcagatg |
43008905 |
T |
 |
| Q |
201 |
atgaagatgatattaatgataatagaatcagcagagctactgctaggtggaggttctgctttttctgtggcatttccattactctactgcctaaggaagt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43008904 |
atgaagatgatattaatgataatagaatgagcagagctactgctagttggaggttctgctttttctgtggcatttccattactctactgcctgaggaagt |
43008805 |
T |
 |
| Q |
301 |
tataaaggtttgagagaggaggatattgagaattaattgagatggcgtttgcagctgggattaggaagaaagagaagttagatttagtttttaaggatct |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43008804 |
tataaaggtttgagagaggaggatattgagaattaattgagatggggtttgcagctgggattaggaagaaagagaagttagatttagtttttaaggatct |
43008705 |
T |
 |
| Q |
401 |
gtg |
403 |
Q |
| |
|
||| |
|
|
| T |
43008704 |
gtg |
43008702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 9 - 73
Target Start/End: Complemental strand, 43015353 - 43015289
Alignment:
| Q |
9 |
ttggtccagatgaaggaactttccccttaggaagcatgttcaggatcaatggcccatatgatttt |
73 |
Q |
| |
|
||||||| |||| ||||||| |||||||||||||||||| | |||||||| |||||| |||||| |
|
|
| T |
43015353 |
ttggtcctgatggaggaactccccccttaggaagcatgttgaagatcaatgtcccatacgatttt |
43015289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University