View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19058_high_29 (Length: 398)
Name: NF19058_high_29
Description: NF19058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19058_high_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 5e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 1 - 160
Target Start/End: Original strand, 6248626 - 6248785
Alignment:
| Q |
1 |
ccaagaaagagcatcttcagtttacaacgggttggtacgggcgggcccgagtaggaaaaacggacccctcggtacccgaacccacccgcagatgcatatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6248626 |
ccaagaaagagcatcttcagtttacaacgggttggtacgggcgggcccgggtaggaaaaacggacccctcgatacccgaacccacccgcagatgcatatc |
6248725 |
T |
 |
| Q |
101 |
atgtgagaggaggataatacacacgccccaacagctgtttctggaacagtgtgatattcc |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6248726 |
atgtgagaggaggataatacacacgccccaacagctgtttctcgaacagtgtgatattcc |
6248785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 132; Significance: 2e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 1 - 160
Target Start/End: Original strand, 43032578 - 43032737
Alignment:
| Q |
1 |
ccaagaaagagcatcttcagtttacaacgggttggtacgggcgggcccgagtaggaaaaacggacccctcggtacccgaacccacccgcagatgcatatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43032578 |
ccaagaaagagcatcttcagtttacaacgggttgatatgggtgggcccgggtaggaaaaacggacccctcggtacccgaacccacccgcagatgcatatc |
43032677 |
T |
 |
| Q |
101 |
atgtgagaggaggataatacacacgccccaacagctgtttctggaacagtgtgatattcc |
160 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
43032678 |
atgtgagcggaggataatacacacgtcccaacagctgtttctcgaacagtgtgatattcc |
43032737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University