View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19058_high_30 (Length: 395)
Name: NF19058_high_30
Description: NF19058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19058_high_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 8 - 349
Target Start/End: Original strand, 44607325 - 44607667
Alignment:
| Q |
8 |
ccaagaatatcattaagcatgagttcacgtgaggtgctttgacgtgccaatctagcagaggcagatcgttgaaccaccctatttgatgaggaggttcgac |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44607325 |
ccaacaatatcattaagcatgagttcacgtgaggtgctttgacgtgccaatctagcagaggcagatcgttgaaccaccctatttgatgaggaggttcgac |
44607424 |
T |
|
| Q |
108 |
catgacggttgcaggtagagagggaacggaagggagtggaggccttgtgggggttctttgacgatgaatcaggttcatcgtcattttgagctttgcgaaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
44607425 |
catgacggttgcaggtagagagggaacggaagggagtggaggccttgtgggggttctttgatgatgaaccgggttcatcgtcattttgagctttgcgaaa |
44607524 |
T |
|
| Q |
208 |
ggattgcatggtaagaatatttggtaatgtgatgtgatgagaatttgcaaaagtagnnnnnnnnncttacaatg--ttgtgttttgttgttgtgattggg |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
44607525 |
ggattgcatggtaagaatatttggtaatgtgatgtgatgagaatttgcaaaagtag-tttttttgcttagaatgttttgtgttttgttgttgtgattggg |
44607623 |
T |
|
| Q |
306 |
ggagcgttgttagcggtgaaaccatgcaatagtggctcgtagtg |
349 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44607624 |
ggagcgttcttagcggtgaaaccatgcaatagtggctcgtagtg |
44607667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University