View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19058_high_60 (Length: 275)
Name: NF19058_high_60
Description: NF19058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19058_high_60 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 257
Target Start/End: Complemental strand, 1367368 - 1367112
Alignment:
| Q |
1 |
aaaagtcgaaagataatgaagaggttttcagtttcgaattctgttagcgatgatacatctccggcaccggggaacaagaacaagaagaaaaagataattg |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
1367368 |
aaaagtcgaaagataatgaagagtttttcagtttcgaattctgttaccgatgatatatctccggcaccggggaacaagaacatgaagaaaaagatgattg |
1367269 |
T |
|
| Q |
101 |
tgactgaagatgctggatcggtggcggaggagatattttcgaaatggaggagagagttagagttagattttccggtgaacggtgatcgtgtggcggtgga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1367268 |
ggactgaagatgctggatcggtggcggaggagatattttcgaaatggaggagagagttagagttagattttccggtgaacggtgatcgtgtggcggtgga |
1367169 |
T |
|
| Q |
201 |
agctatggcggtgtgtttgagaacgtggaagttacttccggtgaaggtggctgctgc |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1367168 |
agctatggcggtgtgtttgagaacgtggaagttacttccggtgaaggtggctgctgc |
1367112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University