View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19058_high_78 (Length: 248)
Name: NF19058_high_78
Description: NF19058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19058_high_78 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 11 - 229
Target Start/End: Original strand, 38569266 - 38569491
Alignment:
| Q |
11 |
cacagatccattttcggcaacttaaacgagtcattcaatatctcaaactccccttcaattatggcttgaaacttaagaaaccggctcatatgaaattaca |
110 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38569266 |
cacagatcccttttcagcaacttaaacgagtcattcaatatctcaaactccccttcaattatggcttgaaacttaagaaaccggctcatatgaaattaca |
38569365 |
T |
|
| Q |
111 |
tgcctttagtgatgcagattggggagactacttagatga------ttc-agtgtcgtggaggtaatttattttggaggtaattcagtgttgtggctatcc |
203 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| ||| | | | |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38569366 |
tgcctttagtgatgcaaattggggagactacttagatgatcacacttctaccttaacgtttgtaatttattttggaggtaattcagtgtcgtggctatcc |
38569465 |
T |
|
| Q |
204 |
aagagacagagaactgtggcacgatc |
229 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
38569466 |
aagagacagagaactgtggcacgatc |
38569491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University