View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19058_low_101 (Length: 222)

Name: NF19058_low_101
Description: NF19058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19058_low_101
NF19058_low_101
[»] chr3 (2 HSPs)
chr3 (15-222)||(48633453-48633663)
chr3 (161-222)||(48626322-48626383)


Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 15 - 222
Target Start/End: Complemental strand, 48633663 - 48633453
Alignment:
15 gagagacttgattgaaccctcaccttaaaattcaccttgaatttaaagatattaaacaactgattttatttt--agtttcataaattttgaag-nnnnnn 111  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||  |||||||||||||||||||           
48633663 gagagacttgattgaaccctcaccttaaaattcaccttaaatttaaagatattaaacaactgattctatttttaagtttcataaattttgaagttttttt 48633564  T
112 nnnnggtttaatttatcaaaaatgttaaagatattgaattgnnnnnnnnattgattttgatggaggtattataattatatcttggtgaaaaaacatgatt 211  Q
        ||||||||||||||||| |||||||||||||||||||        |||||||||||||||||||||||||  |||| |||||||||||||||||||    
48633563 ttttggtttaatttatcaaaactgttaaagatattgaattgttttttttattgattttgatggaggtattataaagatattttggtgaaaaaacatgatt 48633464  T
212 gactctttttt 222  Q
     ||||||||||    
48633463 aactctttttt 48633453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 161 - 222
Target Start/End: Original strand, 48626322 - 48626383
Alignment:
161 attgattttgatggaggtattataattatatcttggtgaaaaaacatgattgactctttttt 222  Q
    ||||||||| ||||||||||||| |  |||| |||||| |||||| ||||||||| ||||||    
48626322 attgattttaatggaggtattatgaaaatattttggtggaaaaacttgattgactatttttt 48626383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University