View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19058_low_101 (Length: 222)
Name: NF19058_low_101
Description: NF19058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19058_low_101 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 15 - 222
Target Start/End: Complemental strand, 48633663 - 48633453
Alignment:
| Q |
15 |
gagagacttgattgaaccctcaccttaaaattcaccttgaatttaaagatattaaacaactgattttatttt--agtttcataaattttgaag-nnnnnn |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
48633663 |
gagagacttgattgaaccctcaccttaaaattcaccttaaatttaaagatattaaacaactgattctatttttaagtttcataaattttgaagttttttt |
48633564 |
T |
 |
| Q |
112 |
nnnnggtttaatttatcaaaaatgttaaagatattgaattgnnnnnnnnattgattttgatggaggtattataattatatcttggtgaaaaaacatgatt |
211 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
48633563 |
ttttggtttaatttatcaaaactgttaaagatattgaattgttttttttattgattttgatggaggtattataaagatattttggtgaaaaaacatgatt |
48633464 |
T |
 |
| Q |
212 |
gactctttttt |
222 |
Q |
| |
|
|||||||||| |
|
|
| T |
48633463 |
aactctttttt |
48633453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 161 - 222
Target Start/End: Original strand, 48626322 - 48626383
Alignment:
| Q |
161 |
attgattttgatggaggtattataattatatcttggtgaaaaaacatgattgactctttttt |
222 |
Q |
| |
|
||||||||| ||||||||||||| | |||| |||||| |||||| ||||||||| |||||| |
|
|
| T |
48626322 |
attgattttaatggaggtattatgaaaatattttggtggaaaaacttgattgactatttttt |
48626383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University