View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19058_low_111 (Length: 204)
Name: NF19058_low_111
Description: NF19058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19058_low_111 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 7e-88; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 19 - 186
Target Start/End: Original strand, 51824400 - 51824567
Alignment:
| Q |
19 |
atcactcaggaaatatgcaaagtaaataacaagaggcaaaccaatttgcacaatggactagaattaaaattaagattttctttactaagaaaatgacatt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51824400 |
atcactcaggaaatatgcaaagtaaataacaagaggccaaccaatttgcacaatggactagaattaaaattaagattttctttactaagaaaatgacatt |
51824499 |
T |
 |
| Q |
119 |
atgcatcaatttctagtgacacaagaggctttggctcttcagcaaaccttgaattggatggaatcagt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51824500 |
atgcatcaatttctagtgacacaagaggctttggctcttcagcaaaccttgaattggatggaatcagt |
51824567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 41 - 117
Target Start/End: Original strand, 51827644 - 51827720
Alignment:
| Q |
41 |
taaataacaagaggcaaaccaatttgcacaatggactagaattaaaattaagattttctttactaagaaaatgacat |
117 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||| | ||||||||||| ||||||||||||||||| |
|
|
| T |
51827644 |
taaataacaagaggcaaatcaatttgcacaatgaactagaatctagattaagatttttaatactaagaaaatgacat |
51827720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University