View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19058_low_14 (Length: 487)
Name: NF19058_low_14
Description: NF19058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19058_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 1e-60; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 160 - 295
Target Start/End: Original strand, 6517808 - 6517945
Alignment:
| Q |
160 |
gcccaacaaataggag--tctaataacttgttatctaacaaatttcttcattaaccaaaagagctttcaaagttaaatacgaaaacataaatcttctttt |
257 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6517808 |
gcccaacaaataggagaatctaataacttgttatctaacaaatttcttcattaaccaaaagagctttcaaaattaaatacgaaaacataaatcttctttt |
6517907 |
T |
|
| Q |
258 |
gtcctaaacacaaaaaccatatctgaaatatgagttga |
295 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6517908 |
gtcctaaaaacaaaaaccatatctgaaatatgagttga |
6517945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 365 - 429
Target Start/End: Original strand, 6518015 - 6518079
Alignment:
| Q |
365 |
ccaacatctcaaccttattttgtaccttctgctccttaaattgaacttggcgagaggcaatccac |
429 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6518015 |
ccaacatctcaaccttattttgtaccttctgctccttaaattgaacttggcgagaggcaatccac |
6518079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 38 - 101
Target Start/End: Original strand, 6517686 - 6517749
Alignment:
| Q |
38 |
gacgactaggttttattagaataacaataacgtgaatttgcataacttgtcaaaatattacaag |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6517686 |
gacgactaggttttattagaataacaataacgtgaatttgcataacttgtcaaaatattacaag |
6517749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University