View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19058_low_24 (Length: 431)
Name: NF19058_low_24
Description: NF19058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19058_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 404; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 404; E-Value: 0
Query Start/End: Original strand, 1 - 416
Target Start/End: Complemental strand, 54637816 - 54637401
Alignment:
| Q |
1 |
gatggctcaattgaagaaccaggtgcaagggaatgataggtctcaggtgtggagctagaaataggtgagtaactcctgtcttgtgattgaggtcctgatt |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54637816 |
gatggctcaattgaagaatcaggtgcaagggaatgataggtctcaggtgtagagctagaaataggtgagtaactcctgtcttgtgattgaggtcctgatt |
54637717 |
T |
|
| Q |
101 |
gcgaaggcaaaatatgatgtggaggcaattctgtgtggggaggagaatcatgaacttctttagaacgagtagtcaagggaggccgcggaggaggtgttcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54637716 |
gcgaaggcaaaatatgatgtggaggcaattctgtgtggggaggagaatcatgaacttctttagaacgagtagtcaagggaggccgcggaggaggtgttcc |
54637617 |
T |
|
| Q |
201 |
aggggaaagagaagaatctgcagaactagatgaagcaagattagattcctgtggttttatgtcaaaatttgttgatcctgttggacatttactggattcc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54637616 |
aggggaaagagaagaatctgcagaactagatgaagcaagattagattcctgtggttttatgtcaaaatttgttgatcctgttggacatttactggattcc |
54637517 |
T |
|
| Q |
301 |
aaacttttttcagatgagcaaattttctcctgaccgatgatgtctgatgtattagccctctgtggaatagaatctactttgtttgtcttttcctcttttc |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54637516 |
aaacttttttcagatgagcaaattttctcctgaccgatgatgtctgatgtattagccctctgtggaatagaatctactttgtttgtcttttcctcttttc |
54637417 |
T |
|
| Q |
401 |
cgctcatatcattatt |
416 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
54637416 |
tgctcatatcattatt |
54637401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University