View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19058_low_53 (Length: 300)
Name: NF19058_low_53
Description: NF19058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19058_low_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 16 - 202
Target Start/End: Original strand, 8315741 - 8315926
Alignment:
| Q |
16 |
atggggttaacacgttttttagataaaaatggcccaaactggnnnnnnnnnnnnnacaaaatgaatttggtaaaaacaaaagagtctcaagtttgaaccc |
115 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| ||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8315741 |
atggggttaacccgttttttagataaaaatggcccaaattggttttttagtttttacaaaatgaatttggcaaaaacaaaagagtctcaagtttgaaccc |
8315840 |
T |
 |
| Q |
116 |
tgcggcgtcacagtctcaaattctgaacgagatatgaccgatcaggtattattgacttgtcaatcattctatagtttaggaattatc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8315841 |
tgcggcgtcacagtctcaaattctgaacgaga-atgaccgatcaggtattattgacttgtcaatcattctatagtttaggaattatc |
8315926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University