View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19058_low_54 (Length: 298)
Name: NF19058_low_54
Description: NF19058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19058_low_54 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 17777610 - 17777670
Alignment:
| Q |
20 |
gcactgtcaaagaatgactatatttgataatattggaatggaatcctaatgtaatatgagg |
80 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17777610 |
gcactgtcaaagaatgacaatatttgataatattggaatggaatcctaatgtaatatgagg |
17777670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University