View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19058_low_54 (Length: 298)

Name: NF19058_low_54
Description: NF19058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19058_low_54
NF19058_low_54
[»] chr4 (1 HSPs)
chr4 (20-80)||(17777610-17777670)


Alignment Details
Target: chr4 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 17777610 - 17777670
Alignment:
20 gcactgtcaaagaatgactatatttgataatattggaatggaatcctaatgtaatatgagg 80  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
17777610 gcactgtcaaagaatgacaatatttgataatattggaatggaatcctaatgtaatatgagg 17777670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University