View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19058_low_62 (Length: 274)
Name: NF19058_low_62
Description: NF19058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19058_low_62 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 7 - 258
Target Start/End: Original strand, 4410918 - 4411169
Alignment:
| Q |
7 |
taaactattccggttctggtgttagaggccgaggaaataaatcaacttcgttgaacacagccaagcgaaggataggaataaatcgcgacgagagtcctat |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4410918 |
taaactattccggttctggtgttagaggccgaggaaataaatcaacttcgtcaaacacaaccaagcgaaggataggaataaatcgcgacgagagtcctat |
4411017 |
T |
|
| Q |
107 |
gtcagaagcttatgctgattcttcattgcaaaggcatgctgttgaatcaaagcaatctcaactcttgatgcttctacagatggtacattgctaaccactt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4411018 |
gtcagaagcttatgctgattcttcattgcaaaggcatgctgttgaatcaaagcaatctcaactcttgatgcttctacagatggtacattgctaaccactt |
4411117 |
T |
|
| Q |
207 |
agattacattacattcatttggttttcgtaaaaccgtttacggtcctgattg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4411118 |
agattacattacattcatttggttttcgtaaaaccgtttatggtcctgattg |
4411169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University