View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19058_low_65 (Length: 267)

Name: NF19058_low_65
Description: NF19058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19058_low_65
NF19058_low_65
[»] chr2 (2 HSPs)
chr2 (16-140)||(38074239-38074363)
chr2 (164-259)||(38074151-38074246)
[»] chr1 (1 HSPs)
chr1 (26-69)||(6283334-6283377)
[»] chr7 (1 HSPs)
chr7 (22-72)||(35221939-35221989)


Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 16 - 140
Target Start/End: Complemental strand, 38074363 - 38074239
Alignment:
16 aatgaaacacctctataatcaattataatccttttaaaaataaaaccaaacatatattaataatattggtattatctgttaaactagatgagacaattgt 115  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38074363 aatgaaacacctctgtaatcaattataatccttttaaaaataaaaccaaacatatattaataatattggtattatctgttaaactagatgagacaattgt 38074264  T
116 gttttaaattgtatcaggttgttgt 140  Q
    ||||||||||||| |||||||||||    
38074263 gttttaaattgtaacaggttgttgt 38074239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 164 - 259
Target Start/End: Complemental strand, 38074246 - 38074151
Alignment:
164 gttgttattgttgcctttatgagtgagacaatttggtgacagagggggatggtggattgattggttcgtgaattttactgtgatgtgatgatgatg 259  Q
    |||||| || |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
38074246 gttgttgttattgcctttatgagtgagacaatttggtgacagtgggggatggtggattgattggttcgtgaattttactgtgatgtgatgatgatg 38074151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 26 - 69
Target Start/End: Original strand, 6283334 - 6283377
Alignment:
26 ctctataatcaattataatccttttaaaaataaaaccaaacata 69  Q
    |||||||||||||| ||||  |||||||||||||||||||||||    
6283334 ctctataatcaattttaattattttaaaaataaaaccaaacata 6283377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 72
Target Start/End: Complemental strand, 35221989 - 35221939
Alignment:
22 acacctctataatcaattataatccttttaaaaataaaaccaaacatatat 72  Q
    ||||||| |||||||||| ||| |||||||| ||| |||||||||||||||    
35221989 acacctcaataatcaattttaacccttttaagaatgaaaccaaacatatat 35221939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University