View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19058_low_68 (Length: 262)
Name: NF19058_low_68
Description: NF19058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19058_low_68 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 20 - 251
Target Start/End: Original strand, 7791354 - 7791578
Alignment:
| Q |
20 |
tttgtatttatccgagtgatcatagtttaattgacaaatatattacatataacatgtggaagtctgatatggactttaaacatctca---cttattcatc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7791354 |
tttgtatttatccgagtgatcatagtttaatcaacaaatatattacatataacat---gaagtctgatatggactttaaacatctcatttattattcatc |
7791450 |
T |
 |
| Q |
117 |
ttatgatatgaatgaaaatctaaccatcacactattttgatnnnnnnnnnntagtgttgtatttattaaaaatattctaaaccaagttttattcaagttt |
216 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||| ||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7791451 |
ttatgatatgaat----atctaaccatcacacta-tttgat--aaaaaaaatagtgttgtatttgttaaaaatattttaaaccaagttttattcaagttt |
7791543 |
T |
 |
| Q |
217 |
tcgtcataaaagctttattaaattattttgttctt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7791544 |
tcgtcataaaagctttattaaattattttgttctt |
7791578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University