View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19058_low_70 (Length: 257)
Name: NF19058_low_70
Description: NF19058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19058_low_70 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 42744118 - 42743886
Alignment:
| Q |
1 |
aatgaccgagctcaagcaacaacggaaatggcttacacagcaaatagaagggtggcagcagctgggttgcacttcattttattc-tagaatgcatcacca |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||||||| |||||||||||||||||||| |||||||| ||||| ||| |||||||||||| || |
|
|
| T |
42744118 |
aatgaccgagctcaagcaacaacggaaatgacttagacagcaaagagaagggtggcagcagctggattgcactttatttttttcatagaatgcatcatca |
42744019 |
T |
 |
| Q |
100 |
aagtgttctttaattactaggaaaatccacatatatatctttgataattaacattgaatcaaactaactcagataaataagttttgaacacattttccaa |
199 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42744018 |
aagtgttcttta----ctaggaaaagccacatatatatctttgataattaacattgaatcaaactaactcagacaaataagttttgaacacattttccaa |
42743923 |
T |
 |
| Q |
200 |
cacatcatagaatgggaagcaataattaagagagaga |
236 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42743922 |
cacatcatagaaagggaagcaataattaagagagaga |
42743886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University