View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19058_low_77 (Length: 250)
Name: NF19058_low_77
Description: NF19058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19058_low_77 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 16 - 250
Target Start/End: Original strand, 51313624 - 51313858
Alignment:
| Q |
16 |
atgggtaacatacgtagcagaatgatgggtgaggtgtgtgatctattttgttataagaagatgtgaaggcagggaggaagtgtctttgatcatttgggca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51313624 |
atgggtaacatacgtagcagaatgatgggtgaggtgtgtgatctattttgttataagaagatgtgaaggcagggaggaagtgtctttgatcatttgggca |
51313723 |
T |
 |
| Q |
116 |
atgtgggattcttccttcctttgaagagcttgctctgggattatggggcttcaatctatgtaatagttactgatttcacaattaataatacactttcttc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51313724 |
atgtgggattcttccttcctttgaagagcttgctctgggattatgggacttcaatctatgtaatagttactgatttcacaattaataatacactttcttc |
51313823 |
T |
 |
| Q |
216 |
ttttctataatttggttcctatcaaaaatcttgaa |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
51313824 |
ttttctataatttggttcctatcaaaaatcttgaa |
51313858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 38 - 73
Target Start/End: Complemental strand, 41574372 - 41574337
Alignment:
| Q |
38 |
tgatgggtgaggtgtgtgatctattttgttataaga |
73 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41574372 |
tgattggtgaggtgtgtgatctattttgttataaga |
41574337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 84
Target Start/End: Original strand, 44211366 - 44211412
Alignment:
| Q |
38 |
tgatgggtgaggtgtgtgatctattttgttataagaagatgtgaagg |
84 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
44211366 |
tgattggtgaggtgtgtgatcaattttgttataagagtatgtgaagg |
44211412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University