View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19058_low_80 (Length: 247)
Name: NF19058_low_80
Description: NF19058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19058_low_80 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 42335970 - 42335735
Alignment:
| Q |
1 |
tttacttcccttgaatatatgtttttgttcgtcgcaattttctgatggttcaatttagttctaacaaaaaattaaattaatcatgtaattatttt-atat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |||| |||| |
|
|
| T |
42335970 |
tttacttcccttgaatatatgtttttgttcgtcgcaattttctgatggttcaatttagttctaacaaaaa-ttaaattaatcgtgtaattttttttatat |
42335872 |
T |
 |
| Q |
100 |
ataggtgacaattgtaatgatagaaagaccgattttatgtcatggatcaattagagtaatatttttgtttaactagattgtgttgcgagaaaattctgat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42335871 |
ataggtgacaattgtaatgatagaaagaccgattttatgtcatggatcaattagaataatatttttgtttaactagattgtgtcgcgagaaaattctgat |
42335772 |
T |
 |
| Q |
200 |
agacttaatgttgtgccacgcgccaccattgatgatg |
236 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42335771 |
agacttaatgttgttccacgcgccaccattgatgatg |
42335735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University