View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19058_low_82 (Length: 245)
Name: NF19058_low_82
Description: NF19058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19058_low_82 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 13 - 229
Target Start/End: Original strand, 28095208 - 28095427
Alignment:
| Q |
13 |
aaaatggggacaaggagaagaagaggaataataagaattcctagttcttcctcttctttggtgtaatgactatgtagattggatttaatatgataaagca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28095208 |
aaaatggggacaaggagaagaagaggaagaataagaattcctagttcttcctcttctttggtgtaatgactatgtagattggatttaatatgataaagca |
28095307 |
T |
 |
| Q |
113 |
tggtgttgtc---cgaatggatttatattttataatgaaatggaatgaaaaggcttgatgaagtggacaagggttattgtgtttcttcactcaattgttt |
209 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28095308 |
tggtgttgtcgtccgaatggatttatattttataatgaaatggaatgaaaaggcttgatgaagtggacaagggttattgtgtttcttcactcaattgttt |
28095407 |
T |
 |
| Q |
210 |
tttggttgcgttgaagtatt |
229 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
28095408 |
tttggttgcgttgaagtatt |
28095427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University