View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19058_low_88 (Length: 238)
Name: NF19058_low_88
Description: NF19058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19058_low_88 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 37804768 - 37805003
Alignment:
| Q |
1 |
caacttaaaaagtttcgagattcctactattatcttttgaaagtataattttccaaactcttttgtaatgtttgttactgccataactagccaagtttat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
37804768 |
caacttaaaaagtttcgagattcctactattatcttttgaaagtataattttccaaactcttttgtaatgtctgttagtgccataactagccaagtttat |
37804867 |
T |
 |
| Q |
101 |
tgaatcta-cttgaaccgtg--------------taatttatgcaatgataaatatgtctatttagttattcttgaatttaatggtgttctttatctagc |
185 |
Q |
| |
|
|||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37804868 |
tgaatctattttgaaccgtgttatttatgcgttcttatttatgcaatgataaatatgtctatttagttattcttgaatttaatggtgttctttatctagc |
37804967 |
T |
 |
| Q |
186 |
taatattgaattgaacttaaggaataattcattact |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
37804968 |
taatattgaattgaacttaaggaataattcattact |
37805003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University