View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19058_low_94 (Length: 233)
Name: NF19058_low_94
Description: NF19058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19058_low_94 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 17 - 222
Target Start/End: Complemental strand, 24589379 - 24589170
Alignment:
| Q |
17 |
actaactaggccacttagttactactctatctttattggtgtggttattaccaaaaaataatttgacattgtgaa----taactatgtggaagtgaaagt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
24589379 |
actaactaggccacttagttactactctgtctttattggtgtggttattaccaaaaaataatttgacattgtgaatacctaaccatgtggaagtgaaagt |
24589280 |
T |
 |
| Q |
113 |
tagaatggnnnnnnnnnnnnnnnnnntgtaatatactaacatgaataatttcatgattagaaaagtaacaataccaatactggattcactgagttatttg |
212 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||| ||||| |
|
|
| T |
24589279 |
tagaatggaaaaagtaagaaataaaatgtaatatactaacatgaataatttcatgattagaaaagtaacaatagcaatatcggattaactgagtcatttg |
24589180 |
T |
 |
| Q |
213 |
ttcatctcac |
222 |
Q |
| |
|
||||| |||| |
|
|
| T |
24589179 |
ttcatttcac |
24589170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University