View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19059_high_3 (Length: 249)
Name: NF19059_high_3
Description: NF19059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19059_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 5 - 156
Target Start/End: Original strand, 37865019 - 37865170
Alignment:
| Q |
5 |
agaagcataggcaaattttgtcaaactaagtgatgaattgttgtgttctttgcacttatttatgtgatttcattagtgacgacttataaggtgataactc |
104 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37865019 |
agaagcgtaggcaaattttgtcaaactaagtgatgaattgttgtgttctttgcatttatttatgtgatttcattagtgacgacttataaggtgataactc |
37865118 |
T |
 |
| Q |
105 |
tacctaccactcataagcacatgtacatgtcatatttcaatgcgagactctt |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37865119 |
tacctaccactcataagcacatgtacatgtcatatttcaatgcgagactctt |
37865170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 221 - 249
Target Start/End: Original strand, 37865170 - 37865198
Alignment:
| Q |
221 |
tgacctgataggagatggttcaacgaatc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37865170 |
tgacctgataggagatggttcaacgaatc |
37865198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University