View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1905_high_11 (Length: 310)
Name: NF1905_high_11
Description: NF1905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1905_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 20 - 301
Target Start/End: Complemental strand, 23996328 - 23996051
Alignment:
| Q |
20 |
gaagggtcagtggatttggtggcttgaggttcgaattatttgagctttctaacctccaggatttaattatgcagaaagataaaatttgaagaggaatttc |
119 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23996328 |
gaagggtcggtggatttggtggcttgaggttcgaattatttgagctttctaacttccaagatttaattatgcagaaagataaaatttgaagaggaatttc |
23996229 |
T |
 |
| Q |
120 |
tcatatttcctgatatttttattctggctaacttcatatcttattagtgaagtgaaggcgtgtgtgcagctggtcatatataggtgtggattgttttgta |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23996228 |
tcatatttcctgatatttttattctggctaacttcatatcttattagtgaagtgaaggcgtgtgtgcagctggtc----ataggtgtggattgttttgta |
23996133 |
T |
 |
| Q |
220 |
gagcagtgttctaggcgtatacatatacggtgtcggataactaaaaagttttccaagtaccatttctaaatatagtgatgat |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23996132 |
gagcagtgttctaggcgtatacatatacggtgtcggataactaaaaagttttccaagtaccatttctaaatatagtgatgat |
23996051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 168
Target Start/End: Complemental strand, 19744472 - 19744319
Alignment:
| Q |
20 |
gaagggtcagtggatttggtggcttgaggttcgaattatttgagc-tttctaacct----ccaggatttaattatgcagaaagataaaatttgaagagga |
114 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||| ||||||||| |||||| ||| | || ||| ||||||||||||||| |||||| ||| |
|
|
| T |
19744472 |
gaagggtcgatggatttggtggcttcaggttcgaagtatttgagcttttctagcctataaactcaatgaaataatgcagaaagataaatattgaagtgga |
19744373 |
T |
 |
| Q |
115 |
atttctcatatttcctgatatttttattctggctaacttcatatcttattagtg |
168 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||| || ||||||||||||| |
|
|
| T |
19744372 |
atttctcatatttcctgatattttgattttggctaacatcttatcttattagtg |
19744319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University