View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1905_high_16 (Length: 274)
Name: NF1905_high_16
Description: NF1905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1905_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 57 - 256
Target Start/End: Complemental strand, 27197629 - 27197431
Alignment:
| Q |
57 |
gtctcacgatgatgtggtggcggcgcttgagaggtcgttgttggtgagtatggaaagtggagtttctaagagtttgagttgagagaatttaggtttaaag |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27197629 |
gtctcacgatgatgtggtggcggcgcttgagaggccgttgttggtgagtatggaaaggggagtttctaagagtttgagttgagagaatttaggtttaaag |
27197530 |
T |
|
| Q |
157 |
agaagtttgtattgtgaaaatgagtaaggtagggccgcttaggtttgaagtgcgnnnnnnnntgaatttatgatgtttaaaatgcaaaaataagtacacc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27197529 |
agaagtttgtattgtgaaaatgagtaaggtagggccgcttaggtttgaagtgcg-aaaaaaatgaatttatgatgtttaaaatgcaaaaataagtacacc |
27197431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University