View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1905_high_20 (Length: 244)
Name: NF1905_high_20
Description: NF1905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1905_high_20 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 10 - 244
Target Start/End: Complemental strand, 46837072 - 46836837
Alignment:
| Q |
10 |
attattctatctatgaagtacggacactgacacaccgacatcacttatagtttgaggagtgttcgtgcttcattgtattctatcaatcatgtagtagaat |
109 |
Q |
| |
|
|||||||||||||||||||||| ||||||| | |||||| ||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46837072 |
attattctatctatgaagtacgaacactgatatgccgacactactaatagtccgaggagtgttcgtgcttcattgtgttctatcaatcatgtagtagaat |
46836973 |
T |
 |
| Q |
110 |
agttaagttattagtgtactattgtgtaatgtt-atgttgtcatcaccatgtgaagatgaaaggtttattggaaaaagggaaaatggcctctttgttttg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46836972 |
agttaagttattagtgtactattgtgtaatgtacatgttgtcatcaccatgtgaagatgaaaggttcattggaaaaagggaaaatggcctctttgttttg |
46836873 |
T |
 |
| Q |
209 |
accaggaggcaggcacagagagataaaggatcccag |
244 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46836872 |
accaggaggcaggcacaaagagataaaggatcccag |
46836837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University