View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1905_high_21 (Length: 241)
Name: NF1905_high_21
Description: NF1905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1905_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 3 - 222
Target Start/End: Complemental strand, 7685643 - 7685424
Alignment:
| Q |
3 |
tttttctagtaatattttattttatttcactaatnnnnnnntcttaaattaactagagaaatttagagaagaaaaccatcaaatcctattttaattgtct |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7685643 |
tttttctagtaatattttattttatttcactaataaaaaaatcttaaattaactagagaaatttagagaagaaaaccatcaaatcctattttaattgtct |
7685544 |
T |
 |
| Q |
103 |
ctaaatttatgacgaggaaattagagagattttattctttctttaaatttgtaatttgtgtgtgatggattggatctcgagtaatttttgttctaattga |
202 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7685543 |
ctaaatttatgacgaggaaattagagacattttattctttctttaaatttgtaatttgtgtgtgatggattggatctcgagttatttttgttctaattga |
7685444 |
T |
 |
| Q |
203 |
ttttctttttattttaggga |
222 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
7685443 |
ttttctttttattttaggga |
7685424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University