View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1905_high_22 (Length: 238)
Name: NF1905_high_22
Description: NF1905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1905_high_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 17 - 227
Target Start/End: Original strand, 17568153 - 17568363
Alignment:
| Q |
17 |
agcgagaaagcggcaatgacgagtgagagaagaaagcgtttgaagctgcaagaacaaaggaactaacgtgtggatagtaatagcgaatctgaatcaaaag |
116 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17568153 |
agcgagaaagcggcaatgacgattgagagaagaaagcgtttgaagctgcaagaacaaaggaactaacgtgtggatagtaatagcgaatctgaatcaaaag |
17568252 |
T |
|
| Q |
117 |
gggtttaatcattcccatgatgttctcttttaatattagttttcaatctgaatcacgttcctcttcttgttgctcgcgttttcttctcactctcacacac |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17568253 |
gggtttaatcattcccatgatgttctcttttcataatagttttcaatctgaatcacgttcctcttcttgttgctcgcgttttcttctcactctcacacac |
17568352 |
T |
|
| Q |
217 |
aaccctttcat |
227 |
Q |
| |
|
||||||||||| |
|
|
| T |
17568353 |
aaccctttcat |
17568363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University