View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1905_low_2 (Length: 422)
Name: NF1905_low_2
Description: NF1905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1905_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 68; Significance: 3e-30; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 130 - 230
Target Start/End: Complemental strand, 29228026 - 29227922
Alignment:
| Q |
130 |
tgctgatgccgaatgccgattaataagtgtatattgatctagtggtgtggtccatgt----gggaaatttataggctcaattcaatgagttcaagaatgt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |||||||| |||||||||| ||||| |
|
|
| T |
29228026 |
tgctgatgccgaatgccgattaataagtgtatattgatctagtggtgtggtccatgtttaagcaaaatttatagtctcaattccatgagttcaataatgt |
29227927 |
T |
|
| Q |
226 |
ggtaa |
230 |
Q |
| |
|
||||| |
|
|
| T |
29227926 |
ggtaa |
29227922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 19 - 75
Target Start/End: Complemental strand, 29228406 - 29228350
Alignment:
| Q |
19 |
ctatctatctaaatatagattagaagacaattcattataacttgaatctaaagtact |
75 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29228406 |
ctatctatctaaaaatagattagaagacaattcattataacttgaatctaaagtact |
29228350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University