View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1905_low_20 (Length: 256)
Name: NF1905_low_20
Description: NF1905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1905_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 9 - 240
Target Start/End: Original strand, 44990847 - 44991078
Alignment:
| Q |
9 |
catcatcatcagtttcaatttccatgtcgatgtcttcttcttcttcagcaaaagagtttggtgctaaagaagagcaagaagaaattgaactgttgggttg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44990847 |
catcatcatcagtttcaatttccatgtcgatgtcttcttcttcttcagcaaaagagtttggtgctaaagaagagcaagaagaaattgagctgttgggttg |
44990946 |
T |
|
| Q |
109 |
accagaaattgaagtggttggatgtgtcaccggagacttggttcgtgtacttccggctagtgagttccgatgggtaggtcttgcatggttatgatctcct |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44990947 |
accagaaattgaagtggttggatgtgtcaccggagacttggttcgtgtactaccggctagtgagttccgatgggtaggtcttgcatggttatgatctcct |
44991046 |
T |
|
| Q |
209 |
gtgtatgtcacagtgaacatgtctgcttcagt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44991047 |
gtgtatgtcacagtgaacatgtctgcttcagt |
44991078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University