View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1905_low_29 (Length: 207)
Name: NF1905_low_29
Description: NF1905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1905_low_29 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 15 - 131
Target Start/End: Original strand, 1987853 - 1987969
Alignment:
| Q |
15 |
ttttcttcattttgtttctcttgctcaccacatgaaccattccttaatattgtttctactctccactttcttctttgaatttcttgacatgattctcatc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1987853 |
ttttcttcattttgtttctcttgctcaccacatgaaccattccttaattttgtttctactctccactttcttctttgaatttcttgacatgattctcatc |
1987952 |
T |
|
| Q |
115 |
atattccttttcatgca |
131 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
1987953 |
atattccttttcatgca |
1987969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University