View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19060_high_19 (Length: 364)
Name: NF19060_high_19
Description: NF19060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19060_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 4e-63; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 186 - 308
Target Start/End: Complemental strand, 27672371 - 27672249
Alignment:
| Q |
186 |
aggttggtctttctagtcaaatcataacagggaagtccattaaaaacattcttgttagagaagcaaaaaaccaggatgctttggctttagtggtagggta |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27672371 |
aggttggtctttctagtcaaatcataacagggaagtccattaaaaacattcttgttagagaagcaaaaaaccaggatgctttggctttagtggtagggta |
27672272 |
T |
 |
| Q |
286 |
tgtggagattgtatttcagaaaa |
308 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
27672271 |
tgtggagattgtatttcagaaaa |
27672249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 27672556 - 27672447
Alignment:
| Q |
1 |
tagtagtgaaataagttacttcaatgcagattatgtttctaaaaacaagagcctaatagatggatatttagaggtttatgaaggcttgtgtgatgtgaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27672556 |
tagtagtgaaataagttacttcaatgcagattatgtttctaaaaacaagagcctaatagatggatatttagaggtttatgaaggcttgtgtgatgtgaaa |
27672457 |
T |
 |
| Q |
101 |
aaggtaaacc |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
27672456 |
aaggtaaacc |
27672447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University